Detail of EST/Unigene AW682877 |
Acc. | AW682877 |
Internal Acc. | NF001C06LF1F1049 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 2-Cys peroxiredoxin BAS1, chloroplastic OS=Spinacia oleracea E-value=2e-50; 2-Cys peroxiredoxin BAS1, chloroplastic OS=Arabidopsis thaliana E-value=2e-50; 2-Cys peroxiredoxin BAS1-like, chloroplastic OS=Arabidopsis thaliana E-value=9e-50; 2-Cys peroxiredoxin BAS1, chloroplastic (Fragment) OS=Triticum aestivum E-value=1e-47; 2-Cys peroxiredoxin BAS1, chloroplastic (Fragment) OS=Hordeum vulgare E-value=1e-47; |
Length | 517 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | CAAACATGGCCTGCTGCTCAGCTCCATCTGCTTCTCTCTTATCTTCAAACCCTAACATCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.11.1.15 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820335 |
Trichome-related Gene from Literature | N/A |