Detail of EST/Unigene AW682906 |
Acc. | AW682906 |
Internal Acc. | NF001G01LF1F1006 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein CP26, chloroplastic OS=Arabidopsis thaliana E-value=1e-35; Chlorophyll a-b binding protein of LHCII type I, chloroplastic OS=Dunaliella tertiolecta E-value=2e-11; Chlorophyll a-b binding protein type 2 member 1B, chloroplastic OS=Pinus sylvestris E-value=4e-10; Chlorophyll a-b binding protein M9, chloroplastic OS=Zea mays E-value=5e-10; Chlorophyll a-b binding protein, chloroplastic OS=Zea mays E-value=5e-10; |
Length | 545 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | TTAATTCATCAAAGCTTAGTTTGAGTTGAAGATTCCTAAAACCAACCATGGCTTCCATTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826626 |
Trichome-related Gene from Literature | N/A |