Detail of EST/Unigene AW683075 |
Acc. | AW683075 |
Internal Acc. | NF007B03LF1F1027 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Protochlorophyllide reductase, chloroplastic OS=Pisum sativum E-value=4e-52; Protochlorophyllide reductase, chloroplastic OS=Cucumis sativus E-value=1e-47; Protochlorophyllide reductase, chloroplastic OS=Daucus carota E-value=5e-43; Protochlorophyllide reductase A, chloroplastic OS=Arabidopsis thaliana E-value=7e-42; Protochlorophyllide reductase B, chloroplastic OS=Arabidopsis thaliana E-value=8e-38; |
Length | 593 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | CTGATTACGCCAAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835507 |
Trichome-related Gene from Literature | N/A |