| Detail of EST/Unigene AW683075 |
| Acc. | AW683075 |
| Internal Acc. | NF007B03LF1F1027 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Protochlorophyllide reductase, chloroplastic OS=Pisum sativum E-value=4e-52; Protochlorophyllide reductase, chloroplastic OS=Cucumis sativus E-value=1e-47; Protochlorophyllide reductase, chloroplastic OS=Daucus carota E-value=5e-43; Protochlorophyllide reductase A, chloroplastic OS=Arabidopsis thaliana E-value=7e-42; Protochlorophyllide reductase B, chloroplastic OS=Arabidopsis thaliana E-value=8e-38; |
| Length | 593 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | CTGATTACGCCAAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835507 |
| Trichome-related Gene from Literature | N/A |