Detail of EST/Unigene AW683118 |
Acc. | AW683118 |
Internal Acc. | NF007G03LF1F1023 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit II, chloroplastic OS=Cucumis sativus E-value=6e-13; Photosystem I reaction center subunit II, chloroplastic OS=Solanum lycopersicum E-value=4e-12; Photosystem I reaction center subunit II, chloroplastic OS=Nicotiana sylvestris E-value=2e-11; Photosystem I reaction center subunit II, chloroplastic OS=Spinacia oleracea E-value=4e-11; |
Length | 274 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | CTTCTTCTTCTTCAACATTCATCAACAACATGGCAATGGCAACTCAAGCCTCTCTCTTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838400 |
Trichome-related Gene from Literature | N/A |