| Detail of EST/Unigene AW683118 |
| Acc. | AW683118 |
| Internal Acc. | NF007G03LF1F1023 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit II, chloroplastic OS=Cucumis sativus E-value=6e-13; Photosystem I reaction center subunit II, chloroplastic OS=Solanum lycopersicum E-value=4e-12; Photosystem I reaction center subunit II, chloroplastic OS=Nicotiana sylvestris E-value=2e-11; Photosystem I reaction center subunit II, chloroplastic OS=Spinacia oleracea E-value=4e-11; |
| Length | 274 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | CTTCTTCTTCTTCAACATTCATCAACAACATGGCAATGGCAACTCAAGCCTCTCTCTTCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 838400 |
| Trichome-related Gene from Literature | N/A |