Detail of EST/Unigene AW683128 |
Acc. | AW683128 |
Internal Acc. | NF007H04LF1F1043 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 1, chloroplastic OS=Pisum sativum E-value=1e-94; Oxygen-evolving enhancer protein 1, chloroplastic OS=Nicotiana tabacum E-value=1e-78; Oxygen-evolving enhancer protein 1, chloroplastic OS=Solanum tuberosum E-value=8e-78; Oxygen-evolving enhancer protein 1, chloroplastic OS=Solanum lycopersicum E-value=4e-76; Oxygen-evolving enhancer protein 1, chloroplastic OS=Helianthus annuus E-value=2e-74; |
Length | 771 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | TGATTACACCAAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836789 |
Trichome-related Gene from Literature | N/A |