| Detail of EST/Unigene AW683155 |
| Acc. | AW683155 |
| Internal Acc. | NF008C05LF1F1037 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ribulose-phosphate 3-epimerase, chloroplastic (Fragment) OS=Solanum tuberosum E-value=7e-69; Ribulose-phosphate 3-epimerase, chloroplastic OS=Spinacia oleracea E-value=4e-68; Ribulose-phosphate 3-epimerase, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-62; Ribulose-phosphate 3-epimerase OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=7e-38; Ribulose-phosphate 3-epimerase OS=Bacillus subtilis (strain 168) E-value=1e-28; |
| Length | 705 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | CTGATTACGCCAAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K01783 ribulose-phosphate 3-epimerase; Metabolism > Carbohydrate Metabolism > ko00030 Pentose phosphate pathway > K01783 ribulose-phosphate 3-epimerase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K01783 ribulose-phosphate 3-epimerase |
| EC | 5.1.3.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 836262 |
| Trichome-related Gene from Literature | N/A |