| Detail of EST/Unigene AW683170 |
| Acc. | AW683170 |
| Internal Acc. | NF008D08LF1F1073 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 29 kDa ribonucleoprotein B, chloroplastic OS=Nicotiana sylvestris E-value=3e-18; 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana plumbaginifolia E-value=9e-18; Ribonucleoprotein At2g37220, chloroplastic OS=Arabidopsis thaliana E-value=2e-17; 29 kDa ribonucleoprotein A, chloroplastic OS=Nicotiana sylvestris E-value=3e-17; 29 kDa ribonucleoprotein, chloroplastic OS=Arabidopsis thaliana E-value=1e-16; |
| Length | 778 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | CTTATTACGCCAAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 5.2.1.8 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842294 |
| Trichome-related Gene from Literature | N/A |