| Detail of EST/Unigene AW683189 |
| Acc. | AW683189 |
| Internal Acc. | NF008F08LF1F1074 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein CP29.3, chloroplastic OS=Arabidopsis thaliana E-value=6e-31; Chlorophyll a-b binding protein CP29.1, chloroplastic OS=Arabidopsis thaliana E-value=4e-26; Chlorophyll a-b binding protein CP29.2, chloroplastic OS=Arabidopsis thaliana E-value=1e-25; Chlorophyll a-b binding protein CP29 OS=Chlamydomonas reinhardtii E-value=7e-12; Chlorophyll a-b binding protein, chloroplastic OS=Petunia hybrida E-value=7e-08; |
| Length | 428 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | CCTAAATCCAAACAAAGCCAGCCACCATGGCAACCACCGCAACCGCCGCCACCATGTCAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818599 |
| Trichome-related Gene from Literature | N/A |