Detail of EST/Unigene AW683258 |
Acc. | AW683258 |
Internal Acc. | NF009G02LF1F1018 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ferredoxin-1, chloroplastic OS=Pisum sativum E-value=8e-30; Ferredoxin-1, chloroplastic OS=Arabidopsis thaliana E-value=3e-14; Ferredoxin-2, chloroplastic OS=Arabidopsis thaliana E-value=3e-13; Ferredoxin-1, chloroplastic OS=Solanum lycopersicum E-value=4e-13; Ferredoxin-1, chloroplastic OS=Mesembryanthemum crystallinum E-value=4e-12; |
Length | 417 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | TGATTCGCCAAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837639 |
Trichome-related Gene from Literature | N/A |