Detail of EST/Unigene AW683334 |
Acc. | AW683334 |
Internal Acc. | NF010G10LF1F1083 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Fructose-1,6-bisphosphatase, chloroplastic OS=Pisum sativum E-value=1e-34; Fructose-1,6-bisphosphatase, chloroplastic OS=Glycine max E-value=4e-34; Fructose-1,6-bisphosphatase, chloroplastic OS=Spinacia oleracea E-value=1e-11; Fructose-1,6-bisphosphatase, chloroplastic OS=Arabidopsis thaliana E-value=7e-10; Fructose-1,6-bisphosphatase, chloroplastic OS=Triticum aestivum E-value=2e-07; |
Length | 380 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | CACAAACCATTACGAACCTTACAATCTCTTTTCCTTCAGTACCATACAACACAATCCATC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824572 |
Trichome-related Gene from Literature | N/A |