| Detail of EST/Unigene AW683334 |
| Acc. | AW683334 |
| Internal Acc. | NF010G10LF1F1083 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Fructose-1,6-bisphosphatase, chloroplastic OS=Pisum sativum E-value=1e-34; Fructose-1,6-bisphosphatase, chloroplastic OS=Glycine max E-value=4e-34; Fructose-1,6-bisphosphatase, chloroplastic OS=Spinacia oleracea E-value=1e-11; Fructose-1,6-bisphosphatase, chloroplastic OS=Arabidopsis thaliana E-value=7e-10; Fructose-1,6-bisphosphatase, chloroplastic OS=Triticum aestivum E-value=2e-07; |
| Length | 380 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | CACAAACCATTACGAACCTTACAATCTCTTTTCCTTCAGTACCATACAACACAATCCATC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824572 |
| Trichome-related Gene from Literature | N/A |