Detail of EST/Unigene AW683393 |
Acc. | AW683393 |
Internal Acc. | NF011F03LF1F1029 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phosphoglycerate kinase, chloroplastic OS=Nicotiana tabacum E-value=2e-20; Phosphoglycerate kinase, chloroplastic OS=Triticum aestivum E-value=1e-18; Phosphoglycerate kinase 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-18; Phosphoglycerate kinase 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-16; Phosphoglycerate kinase, chloroplastic (Fragment) OS=Spinacia oleracea E-value=4e-16; |
Length | 387 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | CTACAATGGCTTCAGCTACAGCCCCCACAACCATCTCACTCCTCCCCACCACTAAATCCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842072 |
Trichome-related Gene from Literature | N/A |