| Detail of EST/Unigene AW683412 |
| Acc. | AW683412 |
| Internal Acc. | NF012B05LF1F1044 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 13, chloroplastic OS=Solanum lycopersicum E-value=6e-73; Chlorophyll a-b binding protein of LHCII type III, chloroplastic OS=Hordeum vulgare E-value=4e-67; Chlorophyll a-b binding protein 4, chloroplastic OS=Solanum lycopersicum E-value=2e-49; Chlorophyll a-b binding protein 37, chloroplastic OS=Petunia sp. E-value=1e-48; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-48; |
| Length | 432 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | GCTCAGCAGCTGTTGTTAAACAAACTCCTTTCCTTGGTCAAAGGAAGGGTGCTGCCAACC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835515 |
| Trichome-related Gene from Literature | N/A |