| Detail of EST/Unigene AW683434 |
| Acc. | AW683434 |
| Internal Acc. | NF012B10LF1F1080 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ferredoxin-1, chloroplastic OS=Pisum sativum E-value=7e-58; Ferredoxin-1, chloroplastic OS=Mesembryanthemum crystallinum E-value=3e-41; Ferredoxin-1, chloroplastic OS=Arabidopsis thaliana E-value=3e-39; Ferredoxin, chloroplastic OS=Capsicum annuum E-value=4e-39; Ferredoxin-2, chloroplastic OS=Arabidopsis thaliana E-value=6e-39; |
| Length | 536 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | CAAAAAAGTAGAAGAAGAAGAAGAAGAAATAATAGTAATGGCAACCACACCTGCTTTGTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837639 |
| Trichome-related Gene from Literature | N/A |