| Detail of EST/Unigene AW683475 |
| Acc. | AW683475 |
| Internal Acc. | NF012F11LF1F1094 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 215, chloroplastic OS=Pisum sativum E-value=2e-11; Chlorophyll a-b binding protein 37, chloroplastic OS=Petunia sp. E-value=8e-11; Chlorophyll a-b binding protein 4, chloroplastic OS=Solanum lycopersicum E-value=8e-11; Chlorophyll a-b binding protein 36, chloroplastic OS=Nicotiana tabacum E-value=8e-11; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. japonica E-value=8e-11; |
| Length | 130 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | CCTAGACCGTACCAAGTACTAGGGTCCATTCTCTGAACAAATTCCATCATACTTTGACTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |