| Detail of EST/Unigene AW683563 |
| Acc. | AW683563 |
| Internal Acc. | NF015H09LF1F1079 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Phosphoribulokinase, chloroplastic OS=Mesembryanthemum crystallinum E-value=2e-23; Phosphoribulokinase, chloroplastic OS=Spinacia oleracea E-value=6e-22; Phosphoribulokinase, chloroplastic OS=Arabidopsis thaliana E-value=2e-20; Phosphoribulokinase, chloroplastic OS=Triticum aestivum E-value=1e-19; Phosphoribulokinase, chloroplastic OS=Chlamydomonas reinhardtii E-value=2e-15; |
| Length | 362 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | ATTCTTTACCTTAGAGAGAAAGAGAGAACAATAATATTGAGTGAGAATGGCAGCTTGTAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 840098 |
| Trichome-related Gene from Literature | N/A |