| Detail of EST/Unigene AW683585 |
| Acc. | AW683585 |
| Internal Acc. | NF016C05LF1F1037 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 1, chloroplastic OS=Pisum sativum E-value=1e-17; Oxygen-evolving enhancer protein 1, chloroplastic OS=Solanum tuberosum E-value=3e-09; Oxygen-evolving enhancer protein 1, chloroplastic OS=Nicotiana tabacum E-value=4e-09; Oxygen-evolving enhancer protein 1, chloroplastic OS=Solanum lycopersicum E-value=6e-09; Oxygen-evolving enhancer protein 1, chloroplastic OS=Helianthus annuus E-value=1e-06; |
| Length | 167 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | GTTAACATAGGAGCAATGGCAGCCTCACCTCCAAGCAGCTGCTACTCTCATGCAACCAAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824246 |
| Trichome-related Gene from Literature | N/A |