Detail of EST/Unigene AW683644 |
Acc. | AW683644 |
Internal Acc. | NF017A10LF1F1072 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem II 10 kDa polypeptide, chloroplastic OS=Nicotiana tabacum E-value=1e-43; Photosystem II 10 kDa polypeptide, chloroplastic OS=Solanum tuberosum E-value=2e-42; Photosystem II 10 kDa polypeptide, chloroplastic OS=Solanum lycopersicum E-value=5e-42; Photosystem II 10 kDa polypeptide, chloroplastic OS=Spinacia oleracea E-value=4e-39; Photosystem II 10 kDa polypeptide, chloroplastic OS=Brassica campestris E-value=2e-38; |
Length | 468 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | TGAGTTTGAAACCAACTCCTTTTAGAGTTGAGAAATCTTCAGTTAGAGGACTACCTGCCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 844245 |
Trichome-related Gene from Literature | N/A |