Detail of EST/Unigene AW683714 |
Acc. | AW683714 |
Internal Acc. | NF018A06LF1F1040 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=3e-59; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=3e-57; Chlorophyll a-b binding protein 48, chloroplastic OS=Zea mays E-value=2e-55; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=2e-51; Chlorophyll a-b binding protein type 1 member F3, chloroplastic OS=Polystichum munitum E-value=5e-51; |
Length | 565 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | ATTTATCAAAAGCACAACAGGCATTTTAATTTCATTGCAAAATGGCCGCATCATCCATGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818006 |
Trichome-related Gene from Literature | N/A |