| Detail of EST/Unigene AW683725 |
| Acc. | AW683725 |
| Internal Acc. | NF018B08LF1F1064 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Linoleate 13S-lipoxygenase 2-1, chloroplastic OS=Solanum tuberosum E-value=4e-28; Lipoxygenase 2.3, chloroplastic OS=Hordeum vulgare E-value=8e-26; Lipoxygenase 3, chloroplastic OS=Arabidopsis thaliana E-value=1e-18; Linoleate 13S-lipoxygenase 3-1, chloroplastic OS=Solanum tuberosum E-value=2e-18; Lipoxygenase 4, chloroplastic OS=Arabidopsis thaliana E-value=8e-18; |
| Length | 648 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | CCCTCTTCTCATTCCTCAATTATTATTTATAGTATAAATCTTAGTGCATTATCTTAAAAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 838314 |
| Trichome-related Gene from Literature | N/A |