Detail of EST/Unigene AW683974 |
Acc. | AW683974 |
Internal Acc. | NF004E12NR1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | NADP-dependent D-sorbitol-6-phosphate dehydrogenase OS=Malus domestica E-value=2e-67; Aldose reductase A OS=Dictyostelium discoideum E-value=5e-38; Aldose reductase B OS=Dictyostelium discoideum E-value=9e-37; Aldose reductase OS=Bos taurus E-value=2e-35; Aldose reductase OS=Oryctolagus cuniculus E-value=2e-35; |
Length | 603 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_ROOT; |
Sequence | TACAACCATATCCCTGGAAACTACCTGGCATGCGATGGAAGGCCTTGTTTCATCGGGCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00011 aldehyde reductase; Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00011 aldehyde reductase |
EC | 1.1.1.149 1.1.1.21 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 816664 |
Trichome-related Gene from Literature | N/A |