Detail of EST/Unigene AW684069 |
Acc. | AW684069 |
Internal Acc. | NF011G02NR1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | NAD(P)H-dependent 6'-deoxychalcone synthase OS=Glycine max E-value=3e-58; NADPH-dependent codeinone reductase 1-2 OS=Papaver somniferum E-value=8e-31; NADPH-dependent codeinone reductase 1-3 OS=Papaver somniferum E-value=1e-30; NADPH-dependent codeinone reductase 1-4 OS=Papaver somniferum E-value=1e-30; NADPH-dependent codeinone reductase 1-5 OS=Papaver somniferum E-value=7e-30; |
Length | 655 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_ROOT; |
Sequence | TAGTGTACCAATCTTAACATTGAACCTTAGTCCAACCCAAAAATAACAACATGGGCAGTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00011 aldehyde reductase; Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00011 aldehyde reductase |
EC | 1.1.1.21 1.1.1.218 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842290 |
Trichome-related Gene from Literature | N/A |