Detail of EST/Unigene AW684296 |
Acc. | AW684296 |
Internal Acc. | NF015B07NR1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=5e-21; Glucan endo-1,3-beta-glucosidase 11 OS=Arabidopsis thaliana E-value=7e-21; Glucan endo-1,3-beta-glucosidase 10 OS=Arabidopsis thaliana E-value=2e-20; Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=3e-20; Glucan endo-1,3-beta-glucosidase 14 OS=Arabidopsis thaliana E-value=3e-19; |
Length | 426 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_ROOT; |
Sequence | CAGAAACCCACTTCAACACTTTCACAGATCATCATAGATTCGCCGTTTCTTTCTTCTCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817201 |
Trichome-related Gene from Literature | N/A |