| Detail of EST/Unigene AW684434 |
| Acc. | AW684434 |
| Internal Acc. | NF016H08NR1F1000 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Acetolactate synthase 2, chloroplastic OS=Nicotiana tabacum SURB E-value=2e-78; Acetolactate synthase, chloroplastic OS=Arabidopsis thaliana 1.2 E-value=1e-77; Acetolactate synthase 3, chloroplastic OS=Brassica napus E-value=2e-77; Acetolactate synthase 1, chloroplastic OS=Nicotiana tabacum SURA E-value=2e-77; Acetolactate synthase 1, chloroplastic OS=Brassica napus E-value=2e-77; |
| Length | 520 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_ROOT; |
| Sequence | CAGGAGTTGAATGTGCAGAAGTTAAAATTTCCTCTTGGTTTTAAGACATTTGAGGATGCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 2.2.1.- 4.1.-.- |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824015 |
| Trichome-related Gene from Literature | N/A |