Detail of EST/Unigene AW684461 |
Acc. | AW684461 |
Internal Acc. | NF017B12NR1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ketol-acid reductoisomerase, chloroplastic OS=Spinacia oleracea E-value=3e-52; Ketol-acid reductoisomerase, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-51; Ketol-acid reductoisomerase, chloroplastic OS=Pisum sativum E-value=1e-50; Ketol-acid reductoisomerase, chloroplastic OS=Arabidopsis thaliana E-value=8e-50; Ketol-acid reductoisomerase OS=Chloroherpeton thalassium (strain ATCC 35110 / GB-78) E-value=1e-06; |
Length | 446 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_ROOT; |
Sequence | CTTGCTGAAGCAAACTCTGATATTGTGGTTAAGGTTGGATTGAGGAAAGGTTCTAGTTCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825030 |
Trichome-related Gene from Literature | N/A |