| Detail of EST/Unigene AW684461 |
| Acc. | AW684461 |
| Internal Acc. | NF017B12NR1F1000 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ketol-acid reductoisomerase, chloroplastic OS=Spinacia oleracea E-value=3e-52; Ketol-acid reductoisomerase, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-51; Ketol-acid reductoisomerase, chloroplastic OS=Pisum sativum E-value=1e-50; Ketol-acid reductoisomerase, chloroplastic OS=Arabidopsis thaliana E-value=8e-50; Ketol-acid reductoisomerase OS=Chloroherpeton thalassium (strain ATCC 35110 / GB-78) E-value=1e-06; |
| Length | 446 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_ROOT; |
| Sequence | CTTGCTGAAGCAAACTCTGATATTGTGGTTAAGGTTGGATTGAGGAAAGGTTCTAGTTCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 825030 |
| Trichome-related Gene from Literature | N/A |