Detail of EST/Unigene AW684598 |
Acc. | AW684598 |
Internal Acc. | NF018G07NR1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Protein HIRA OS=Zea mays E-value=2e-08; Protein HIRA OS=Oryza sativa subsp. japonica E-value=6e-08; Protein HIRA OS=Arabidopsis thaliana E-value=7e-08; Uncharacterized WD repeat-containing protein alr3466 OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=5e-06; Transcriptional repressor tup11 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=7e-06; |
Length | 621 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_ROOT; |
Sequence | TGCAAAACAGCCAAACATGTATAACTTTTTTCATCAATTCCTCTTTTCCATAATCTAACA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Transcription > ko03022 Basal transcription factors > K03130 transcription initiation factor TFIID subunit D4; Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03362 F-box and WD-40 domain protein 1/11; Environmental Information Processing > Signal Transduction > ko04340 Hedgehog signaling pathway > K03362 F-box and WD-40 domain protein 1/11; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03362 F-box and WD-40 domain protein 1/11 |
EC | 6.3.2.19 |
Transcription Factor Family | C3H |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839025 |
Trichome-related Gene from Literature | N/A |