Detail of EST/Unigene AW684778 |
Acc. | AW684778 |
Internal Acc. | NF021A03NR1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ubiquinone biosynthesis protein COQ9, mitochondrial OS=Drosophila melanogaster E-value=2e-13; Ubiquinone biosynthesis protein COQ9, mitochondrial OS=Xenopus tropicalis E-value=3e-10; Ubiquinone biosynthesis protein COQ9-B, mitochondrial OS=Xenopus laevis E-value=2e-09; Ubiquinone biosynthesis protein COQ9-A, mitochondrial OS=Xenopus laevis E-value=3e-09; Ubiquinone biosynthesis protein COQ9, mitochondrial OS=Homo sapiens E-value=3e-09; |
Length | 661 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_ROOT; |
Sequence | GTCAGAAACAACGGCGGCGACGGAATGTACCGAACGGCGGCGAAGCGGTTGCTGTGCAGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838497 |
Trichome-related Gene from Literature | N/A |