Detail of EST/Unigene AW684796 |
Acc. | AW684796 |
Internal Acc. | NF021B11NR1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 4-coumarate--CoA ligase-like 7 OS=Arabidopsis thaliana E-value=3e-57; 4-coumarate--CoA ligase-like 1 OS=Oryza sativa subsp. japonica E-value=1e-40; 4-coumarate--CoA ligase-like 5 OS=Arabidopsis thaliana E-value=7e-29; 4-coumarate--CoA ligase 3 OS=Arabidopsis thaliana E-value=1e-27; 4-coumarate--CoA ligase 4 OS=Arabidopsis thaliana E-value=1e-27; |
Length | 670 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_ROOT; |
Sequence | CAAACCTCTCTCTCGTAACACACCTCTTCAACAAAGTCACTTCTTCCCCAAACAAAACCG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01895 acetyl-CoA synthetase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K01904 4-coumarate--CoA ligase |
EC | 6.2.1.1 6.2.1.12 |
Transcription Factor Family | |
Transporter Classification Family | 2.A.1 Major facilitator superfamily MFS |
Probeset |
|
Corresponding NCBI Gene | 825864 |
Trichome-related Gene from Literature | N/A |