| Detail of EST/Unigene AW684883 |
| Acc. | AW684883 |
| Internal Acc. | NF022F05NR1F1000 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Dihydrodipicolinate synthase 2, chloroplastic OS=Arabidopsis thaliana E-value=9e-36; Dihydrodipicolinate synthase, chloroplastic OS=Coix lachryma-jobi E-value=1e-34; Dihydrodipicolinate synthase 2, chloroplastic OS=Triticum aestivum E-value=1e-34; Dihydrodipicolinate synthase 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-34; Dihydrodipicolinate synthase, chloroplastic OS=Zea mays E-value=3e-34; |
| Length | 667 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_ROOT; |
| Sequence | TATCTTTGTATCCTGTCTCTTGTTACTGTTACTTTGACCTTTCCTTCTCCTCAAATTCAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 819152 |
| Trichome-related Gene from Literature | N/A |