Detail of EST/Unigene AW684883 |
Acc. | AW684883 |
Internal Acc. | NF022F05NR1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Dihydrodipicolinate synthase 2, chloroplastic OS=Arabidopsis thaliana E-value=9e-36; Dihydrodipicolinate synthase, chloroplastic OS=Coix lachryma-jobi E-value=1e-34; Dihydrodipicolinate synthase 2, chloroplastic OS=Triticum aestivum E-value=1e-34; Dihydrodipicolinate synthase 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-34; Dihydrodipicolinate synthase, chloroplastic OS=Zea mays E-value=3e-34; |
Length | 667 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_ROOT; |
Sequence | TATCTTTGTATCCTGTCTCTTGTTACTGTTACTTTGACCTTTCCTTCTCCTCAAATTCAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819152 |
Trichome-related Gene from Literature | N/A |