| Detail of EST/Unigene AW684996 |
| Acc. | AW684996 |
| Internal Acc. | NF024A08NR1F1000 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Threonine dehydratase biosynthetic, chloroplastic OS=Arabidopsis thaliana E-value=3e-29; Threonine dehydratase biosynthetic, chloroplastic OS=Solanum lycopersicum E-value=1e-17; Threonine dehydratase, mitochondrial OS=Blastobotrys adeninivorans E-value=9e-14; Threonine dehydratase biosynthetic, chloroplastic OS=Cicer arietinum E-value=1e-12; L-threonine dehydratase biosynthetic IlvA OS=Pasteurella multocida (strain Pm70) E-value=4e-11; |
| Length | 548 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_ROOT; |
| Sequence | ATAAAGCAAAGCTCGTAAGATTTTATTTGAGTCAAACAAAATTTGTGTCTGAAATCAGAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820166 |
| Trichome-related Gene from Literature | N/A |