Detail of EST/Unigene AW684996 |
Acc. | AW684996 |
Internal Acc. | NF024A08NR1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Threonine dehydratase biosynthetic, chloroplastic OS=Arabidopsis thaliana E-value=3e-29; Threonine dehydratase biosynthetic, chloroplastic OS=Solanum lycopersicum E-value=1e-17; Threonine dehydratase, mitochondrial OS=Blastobotrys adeninivorans E-value=9e-14; Threonine dehydratase biosynthetic, chloroplastic OS=Cicer arietinum E-value=1e-12; L-threonine dehydratase biosynthetic IlvA OS=Pasteurella multocida (strain Pm70) E-value=4e-11; |
Length | 548 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_ROOT; |
Sequence | ATAAAGCAAAGCTCGTAAGATTTTATTTGAGTCAAACAAAATTTGTGTCTGAAATCAGAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820166 |
Trichome-related Gene from Literature | N/A |