Detail of EST/Unigene AW685050 |
Acc. | AW685050 |
Internal Acc. | NF024F09NR1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-fructofuranosidase, cell wall isozyme OS=Pisum sativum E-value=6e-83; Beta-fructofuranosidase, insoluble isoenzyme CWINV1 OS=Arabidopsis thaliana E-value=3e-62; Beta-fructofuranosidase, insoluble isoenzyme 3 OS=Oryza sativa subsp. japonica E-value=1e-54; Beta-fructofuranosidase, insoluble isoenzyme 3 OS=Oryza sativa subsp. indica E-value=1e-54; Beta-fructofuranosidase, insoluble isoenzyme CWINV3 OS=Arabidopsis thaliana E-value=9e-53; |
Length | 502 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_ROOT; |
Sequence | GCTGAAATGTACATGCAGACCCCAATGGACCAATGAGATATGGAGGACTTTATCATCTGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820591 |
Trichome-related Gene from Literature | N/A |