Detail of EST/Unigene AW685252 |
Acc. | AW685252 |
Internal Acc. | NF027G02NR1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ferredoxin-3, chloroplastic OS=Zea mays E-value=1e-45; Ferredoxin-3, chloroplastic OS=Arabidopsis thaliana E-value=3e-44; Ferredoxin-1, chloroplastic OS=Mesembryanthemum crystallinum E-value=6e-39; Ferredoxin-6, chloroplastic OS=Zea mays E-value=4e-38; Ferredoxin, root R-B1 OS=Raphanus sativus E-value=2e-37; |
Length | 592 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_ROOT; |
Sequence | ACATAATTCACATCGTTTTTTCCGCTTCCATCTCCAACTAACGCCACCATCATCTGGTGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817297 |
Trichome-related Gene from Literature | N/A |