| Detail of EST/Unigene AW685454 |
| Acc. | AW685454 |
| Internal Acc. | NF029H02NR1F1000 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | (3S,6E)-nerolidol synthase 1 OS=Fragaria ananassa E-value=3e-50; (3S,6E)-nerolidol synthase 2, chloroplastic/mitochondrial OS=Fragaria ananassa E-value=1e-48; (3S,6E)-nerolidol synthase 1, chloroplastic OS=Fragaria vesca E-value=1e-48; S-(+)-linalool synthase, chloroplastic OS=Arabidopsis thaliana E-value=2e-33; Geraniol synthase, chloroplastic OS=Ocimum basilicum E-value=2e-30; |
| Length | 674 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_ROOT; |
| Sequence | CGGCACGAGGCAAGTATACATTTTCTGAGGATATAAATGGAATGATTGCATTGTTTGAAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842465 |
| Trichome-related Gene from Literature | N/A |