Detail of EST/Unigene AW685457 |
Acc. | AW685457 |
Internal Acc. | NF029H05NR1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, chloroplastic OS=Glycine max E-value=1e-30; Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=4e-22; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=8e-20; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=3e-18; Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=3e-18; |
Length | 612 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_ROOT; |
Sequence | ATCCTTTTTTTCATTCTCTCTTAAAGCCATAAACTTTCTTCAACCCAACTCACAGAATTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820288 |
Trichome-related Gene from Literature | 820288 |