| Detail of EST/Unigene AW685488 |
| Acc. | AW685488 |
| Internal Acc. | NF030E12NR1F1000 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Replication factor A protein 1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=1e-10; Replication protein A 70 kDa DNA-binding subunit OS=Mus musculus E-value=7e-07; Replication protein A 70 kDa DNA-binding subunit OS=Drosophila melanogaster E-value=1e-06; Replication protein A 70 kDa DNA-binding subunit OS=Xenopus laevis E-value=2e-06; |
| Length | 423 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_ROOT; |
| Sequence | GATTCGCTACGTTGACTAAATTTTATGTTGTGCATCGAATTTTGCACGAAAAAAATCCAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K07466 replication factor A1; Genetic Information Processing > Replication and Repair > ko03440 Homologous recombination > K07466 replication factor A1; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K07466 replication factor A1; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K07466 replication factor A1 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827651 |
| Trichome-related Gene from Literature | N/A |