Detail of EST/Unigene AW685505 |
Acc. | AW685505 |
Internal Acc. | NF030H05NR1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamine synthetase nodule isozyme OS=Medicago sativa E-value=5e-96; Glutamine synthetase root isozyme A OS=Pisum sativum E-value=7e-94; Glutamine synthetase root isozyme B OS=Pisum sativum E-value=3e-93; Glutamine synthetase PR-2 OS=Phaseolus vulgaris E-value=1e-92; Glutamine synthetase nodule isozyme OS=Vigna aconitifolia E-value=1e-90; |
Length | 648 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_ROOT; |
Sequence | GTTCTTCTTCTTCCTTCACTATTCATCATCATGTCTTTGCTTTCAGATCTCATCAACCTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01915 glutamine synthetase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01915 glutamine synthetase; Metabolism > Glycan Biosynthesis and Metabolism > ko00550 Peptidoglycan biosynthesis > K01915 glutamine synthetase; Environmental Information Processing > Signal Transduction > ko02020 Two-component system > K01915 glutamine synthetase |
EC | 6.3.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 833738 |
Trichome-related Gene from Literature | N/A |