Detail of EST/Unigene AW685581 |
Acc. | AW685581 |
Internal Acc. | NF029C02NR1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | (3S,6E)-nerolidol synthase 1, chloroplastic OS=Fragaria vesca E-value=5e-22; (3S,6E)-nerolidol synthase 2, chloroplastic/mitochondrial OS=Fragaria ananassa E-value=1e-21; (3S,6E)-nerolidol synthase 1 OS=Fragaria ananassa E-value=5e-21; Tricyclene synthase 1e20, chloroplastic OS=Antirrhinum majus E-value=2e-19; Tricyclene synthase Oc15, chloroplastic OS=Antirrhinum majus E-value=2e-19; |
Length | 662 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_ROOT; |
Sequence | CCGAATCAAGTCTGTTTTATTATCAAAGCATTAATTTCTAGAATGGATGTTACATATGTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827377 |
Trichome-related Gene from Literature | N/A |