Detail of EST/Unigene AW685791 |
Acc. | AW685791 |
Internal Acc. | NF030C11NR1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 76C3 OS=Arabidopsis thaliana E-value=2e-34; Geraniol 8-hydroxylase OS=Catharanthus roseus E-value=2e-34; Cytochrome P450 76C4 OS=Arabidopsis thaliana E-value=2e-33; Cytochrome P450 76C2 OS=Arabidopsis thaliana E-value=3e-33; Cytochrome P450 76C1 OS=Arabidopsis thaliana E-value=1e-32; |
Length | 665 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_ROOT; |
Sequence | CTCAAAAACAAAATAGCCATGAACCACCAAACACTTCTACTAGTGGTTACCTTTGCAAGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07410 cytochrome P450, family 1, subfamily B, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07410 cytochrome P450, family 1, subfamily B, polypeptide 1 |
EC | 1.14.14.1 1.14.99.9 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819166 |
Trichome-related Gene from Literature | N/A |