| Detail of EST/Unigene AW685936 |
| Acc. | AW685936 |
| Internal Acc. | NF036F06NR1F1000 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 14 OS=Arabidopsis thaliana E-value=1e-46; Glucan endo-1,3-beta-glucosidase 11 OS=Arabidopsis thaliana E-value=4e-39; Glucan endo-1,3-beta-glucosidase 10 OS=Arabidopsis thaliana E-value=1e-33; Glucan endo-1,3-beta-glucosidase 12 OS=Arabidopsis thaliana E-value=2e-24; Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=3e-24; |
| Length | 617 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_ROOT; |
| Sequence | GTTTTGATTTCTCAGCCTTCATTTTTGGGTGAGAATGGCAATCTCTTCCTTCTGCTTCAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817295 |
| Trichome-related Gene from Literature | N/A |