| Detail of EST/Unigene AW686273 |
| Acc. | AW686273 |
| Internal Acc. | NF039H07NR1F1000 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | GDP-mannose 3,5-epimerase OS=Arabidopsis thaliana E-value=0; GDP-mannose 3,5-epimerase 1 OS=Oryza sativa subsp. japonica E-value=0; GDP-mannose 3,5-epimerase 1 OS=Oryza sativa subsp. indica E-value=0; GDP-mannose 3,5-epimerase 2 OS=Oryza sativa subsp. japonica E-value=8e-98; GDP-L-fucose synthase OS=Escherichia coli (strain K12) E-value=4e-11; |
| Length | 637 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_ROOT; |
| Sequence | CTCATACCTCTTCTCTCCGTACATTATCGTCATATCAATCAATCAGAATGGGAAGCACTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 4.1.1.35 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 833002 |
| Trichome-related Gene from Literature | N/A |