Detail of EST/Unigene AW686363 |
Acc. | AW686363 |
Internal Acc. | NF037B04NR1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Mitogen-activated protein kinase homolog MMK2 OS=Medicago sativa E-value=2e-60; Mitogen-activated protein kinase 4 OS=Arabidopsis thaliana E-value=5e-59; Mitogen-activated protein kinase 2 OS=Oryza sativa subsp. japonica E-value=1e-57; Mitogen-activated protein kinase 5 OS=Arabidopsis thaliana E-value=9e-57; Mitogen-activated protein kinase 6 OS=Oryza sativa subsp. japonica E-value=6e-56; |
Length | 460 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_ROOT; |
Sequence | TTCTGGTTTAATTTGGATTCTTAACTTCTACACAAGACAGACATGTCTCTTGCTTCATCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04441 p38 MAP kinase; Environmental Information Processing > Signal Transduction > ko04011 MAPK signaling pathway - yeast > K04441 p38 MAP kinase; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04441 p38 MAP kinase; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04464 mitogen-activated protein kinase 7; Environmental Information Processing > Signal Transduction > ko04011 MAPK signaling pathway - yeast > K04464 mitogen-activated protein kinase 7 |
EC | 2.7.11.24 2.7.1.37 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828151 |
Trichome-related Gene from Literature | N/A |