| Detail of EST/Unigene AW686379 |
| Acc. | AW686379 |
| Internal Acc. | NF040H09NR1F1000 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable acyl-activating enzyme 5, peroxisomal OS=Arabidopsis thaliana E-value=2e-40; Probable acyl-activating enzyme 6 OS=Arabidopsis thaliana E-value=7e-39; Probable acyl-activating enzyme 8 OS=Arabidopsis thaliana E-value=1e-37; Probable acyl-activating enzyme 9 OS=Arabidopsis thaliana E-value=7e-34; Probable acyl-activating enzyme 1, peroxisomal OS=Arabidopsis thaliana E-value=9e-33; |
| Length | 369 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_ROOT; |
| Sequence | GTGATTATTAGTGGTGGTGAGAATTTGAGTAGTGTGGAGGTTGAGTCGGTTTTGTATGGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01895 acetyl-CoA synthetase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K01897 long-chain acyl-CoA synthetase |
| EC | 6.2.1.3 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 831498 |
| Trichome-related Gene from Literature | N/A |