Detail of EST/Unigene AW686379 |
Acc. | AW686379 |
Internal Acc. | NF040H09NR1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable acyl-activating enzyme 5, peroxisomal OS=Arabidopsis thaliana E-value=2e-40; Probable acyl-activating enzyme 6 OS=Arabidopsis thaliana E-value=7e-39; Probable acyl-activating enzyme 8 OS=Arabidopsis thaliana E-value=1e-37; Probable acyl-activating enzyme 9 OS=Arabidopsis thaliana E-value=7e-34; Probable acyl-activating enzyme 1, peroxisomal OS=Arabidopsis thaliana E-value=9e-33; |
Length | 369 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_ROOT; |
Sequence | GTGATTATTAGTGGTGGTGAGAATTTGAGTAGTGTGGAGGTTGAGTCGGTTTTGTATGGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01895 acetyl-CoA synthetase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K01897 long-chain acyl-CoA synthetase |
EC | 6.2.1.3 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 831498 |
Trichome-related Gene from Literature | N/A |