| Detail of EST/Unigene AW686670 |
| Acc. | AW686670 |
| Internal Acc. | NF040F01NR1F1000 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Digalactosyldiacylglycerol synthase 2, chloroplastic OS=Glycine max E-value=1e-28; Digalactosyldiacylglycerol synthase 2, chloroplastic OS=Lotus japonicus E-value=3e-27; Digalactosyldiacylglycerol synthase 2, chloroplastic OS=Arabidopsis thaliana E-value=7e-25; Digalactosyldiacylglycerol synthase 1, chloroplastic OS=Arabidopsis thaliana E-value=6e-24; Digalactosyldiacylglycerol synthase 1, chloroplastic OS=Glycine max E-value=3e-22; |
| Length | 420 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_ROOT; |
| Sequence | CGCTGCTTCTCTGCCACCCAATCGTCGCCGCTGCTTCTCTCCTTCTTTCCACCGCCACCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827960 |
| Trichome-related Gene from Literature | N/A |