Detail of EST/Unigene AW686758 |
Acc. | AW686758 |
Internal Acc. | NF042D06NR1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Potassium channel GORK OS=Arabidopsis thaliana E-value=2e-15; Potassium channel KOR1 OS=Oryza sativa subsp. japonica E-value=1e-13; Glutaminase liver isoform, mitochondrial OS=Mus musculus E-value=2e-13; Glutaminase liver isoform, mitochondrial OS=Rattus norvegicus E-value=3e-13; Potassium channel AKT6 OS=Arabidopsis thaliana E-value=5e-13; |
Length | 643 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_ROOT; |
Sequence | GTTAAAACTTGTTCACAAGTGTCACAAGAAAAAAATTCAATTCAACGCAAATCATAAACA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01425 glutaminase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01425 glutaminase; Metabolism > Metabolism of Other Amino Acids > ko00471 D-Glutamine and D-glutamate metabolism > K01425 glutaminase |
EC | 3.1.1.47 3.1.1.5 3.5.1.1 3.5.1.2 |
Transcription Factor Family | CAMTA |
Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC |
Probeset |
|
Corresponding NCBI Gene | 827630 |
Trichome-related Gene from Literature | N/A |