| Detail of EST/Unigene AW686774 |
| Acc. | AW686774 |
| Internal Acc. | NF042F10NR1F1000 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | GDP-mannose 3,5-epimerase OS=Arabidopsis thaliana E-value=2e-97; GDP-mannose 3,5-epimerase 1 OS=Oryza sativa subsp. japonica E-value=4e-95; GDP-mannose 3,5-epimerase 1 OS=Oryza sativa subsp. indica E-value=2e-94; GDP-mannose 3,5-epimerase 2 OS=Oryza sativa subsp. japonica E-value=8e-91; Protein CapI OS=Staphylococcus aureus E-value=8e-08; |
| Length | 659 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_ROOT; |
| Sequence | CTCAACTCATACCTCTTCTCTCCGTACATTATCGTCATATCAATCAATCAGAATGGGAAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 5.1.3.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 833002 |
| Trichome-related Gene from Literature | N/A |