| Detail of EST/Unigene AW686787 |
| Acc. | AW686787 |
| Internal Acc. | NF042H11NR1F1000 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glycogen synthase kinase-3 homolog MsK-2 OS=Medicago sativa E-value=3e-82; Glycogen synthase kinase-3 homolog MsK-3 OS=Medicago sativa E-value=2e-77; Shaggy-related protein kinase alpha OS=Arabidopsis thaliana E-value=5e-72; Shaggy-related protein kinase gamma OS=Arabidopsis thaliana E-value=1e-71; Shaggy-related protein kinase epsilon OS=Arabidopsis thaliana E-value=1e-71; |
| Length | 577 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_ROOT; |
| Sequence | TAATGGAACAATTAACAAAAGAGAGACTATTAACAACATGAAACAGGCTAGATGCAATTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K03083 glycogen synthase kinase 3 beta; Environmental Information Processing > Signal Transduction > ko04340 Hedgehog signaling pathway > K03083 glycogen synthase kinase 3 beta; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03083 glycogen synthase kinase 3 beta |
| EC | 2.7.11.26 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 832733 |
| Trichome-related Gene from Literature | N/A |