Detail of EST/Unigene AW686881 |
Acc. | AW686881 |
Internal Acc. | NF003E07RT1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-fructofuranosidase, cell wall isozyme OS=Pisum sativum E-value=0; Beta-fructofuranosidase, insoluble isoenzyme CWINV1 OS=Arabidopsis thaliana E-value=6e-96; Beta-fructofuranosidase, insoluble isoenzyme 1 OS=Daucus carota E-value=7e-89; Beta-fructofuranosidase, insoluble isoenzyme 3 OS=Oryza sativa subsp. japonica E-value=3e-85; Beta-fructofuranosidase, insoluble isoenzyme 3 OS=Oryza sativa subsp. indica E-value=3e-85; |
Length | 647 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DROOT; |
Sequence | TGATGATTCCTTCAAACAACCTTACAGAACTGCTTATCATTTCCAACCTCCAAAGAATTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820591 |
Trichome-related Gene from Literature | N/A |