| Detail of EST/Unigene AW686921 |
| Acc. | AW686921 |
| Internal Acc. | NF004A08RT1F1056 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Mitogen-activated protein kinase 3 OS=Arabidopsis thaliana E-value=2e-73; Mitogen-activated protein kinase homolog MMK1 OS=Medicago sativa E-value=2e-67; Mitogen-activated protein kinase homolog D5 OS=Pisum sativum E-value=6e-67; Mitogen-activated protein kinase homolog NTF4 OS=Nicotiana tabacum E-value=3e-65; Mitogen-activated protein kinase 1 OS=Oryza sativa subsp. japonica E-value=4e-65; |
| Length | 644 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DROOT; |
| Sequence | CTGAATTGTTGTTGAACTCCTCAGATTACACCTCTGCAATAGATGTCTGGTCTGTTGGTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04371 extracellular signal-regulated kinase 1/2 |
| EC | 2.7.11.24 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 823706 |
| Trichome-related Gene from Literature | N/A |