Detail of EST/Unigene AW686927 |
Acc. | AW686927 |
Internal Acc. | NF004B02RT1F1015 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 18 OS=Arabidopsis thaliana E-value=1e-51; Probable beta-1,3-galactosyltransferase 19 OS=Arabidopsis thaliana E-value=8e-51; Probable beta-1,3-galactosyltransferase 17 OS=Arabidopsis thaliana E-value=6e-49; Probable beta-1,3-galactosyltransferase 20 OS=Arabidopsis thaliana E-value=8e-37; |
Length | 382 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DROOT; |
Sequence | GAGGATGAAAAGGTGTTAGTGTCACAGTTTATGATGGAGCTTCAAGGATTGAAGGTAGTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843819 |
Trichome-related Gene from Literature | N/A |