| Detail of EST/Unigene AW686927 |
| Acc. | AW686927 |
| Internal Acc. | NF004B02RT1F1015 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 18 OS=Arabidopsis thaliana E-value=1e-51; Probable beta-1,3-galactosyltransferase 19 OS=Arabidopsis thaliana E-value=8e-51; Probable beta-1,3-galactosyltransferase 17 OS=Arabidopsis thaliana E-value=6e-49; Probable beta-1,3-galactosyltransferase 20 OS=Arabidopsis thaliana E-value=8e-37; |
| Length | 382 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DROOT; |
| Sequence | GAGGATGAAAAGGTGTTAGTGTCACAGTTTATGATGGAGCTTCAAGGATTGAAGGTAGTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 843819 |
| Trichome-related Gene from Literature | N/A |