Detail of EST/Unigene AW686969 |
Acc. | AW686969 |
Internal Acc. | NF004E08RT1F1066 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable chlorophyll(ide) b reductase NYC1, chloroplastic OS=Arabidopsis thaliana E-value=1e-75; Probable chlorophyll(ide) b reductase NYC1, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-73; Chlorophyll(ide) b reductase NOL, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-33; Chlorophyll(ide) b reductase NOL, chloroplastic OS=Arabidopsis thaliana E-value=5e-32; Carbonyl reductase family member 4 OS=Xenopus tropicalis E-value=5e-11; |
Length | 586 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DROOT; |
Sequence | ACTTCACGAAGCCCTGAGTCTGTGCAAGCAACTGTCAAAGAGCTTGAGGAAAATCTAAAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.1.1.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826942 |
Trichome-related Gene from Literature | N/A |