Detail of EST/Unigene AW686999 |
Acc. | AW686999 |
Internal Acc. | NF004H02RT1F1026 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome b5 OS=Brassica oleracea var. botrytis E-value=1e-35; Cytochrome b5 isoform 1 OS=Arabidopsis thaliana E-value=3e-34; Probable cytochrome b5 isoform 2 OS=Arabidopsis thaliana E-value=1e-33; Cytochrome b5 OS=Nicotiana tabacum E-value=3e-33; Cytochrome b5 OS=Borago officinalis E-value=2e-31; |
Length | 346 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DROOT; |
Sequence | ATGTGGCTAAGCACAATCACAAGAACGATTGCTGGATCATAGTCAACAAAAAGGTATATG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00530 Aminosugars metabolism > K00326 cytochrome-b5 reductase; Metabolism > Lipid Metabolism > ko00592 alpha-Linolenic acid metabolism > K10226 fatty acid desaturase 2 (delta-6 desaturase); Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K10226 fatty acid desaturase 2 (delta-6 desaturase) |
EC | 1.14.19.- 1.6.2.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835438 |
Trichome-related Gene from Literature | N/A |